Select Question Set:
Q. No.If a radiolable is used to tag a DNA molecule, the technique used to localise would be
1. X-ray crystallography
2. Autoradiography
3. Fluorescence microscopy
4. Electron microscopy
Subtopic: Human Genome Project | DNA Fingerprinting |
78%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.
Match the following with their functions.
1. i-b, ii-a, iii-c,
2. i-,a, ii-b, iii-c
3. i-b, ii-c, iii-a
4. i-c, ii-a, iii-b
| Column I | Column II | ||
| i. | m-RNA | a. | Carries activated amino acids for elongation of polypeptide chain. |
| ii. | r-RNA | b. | Carries genetic information from nucleus to the site of protein synthesis. |
| ii. | t-RNA | c. | Associated with ribosome. |
2. i-,a, ii-b, iii-c
3. i-b, ii-c, iii-a
4. i-c, ii-a, iii-b
Subtopic: Translation |
77%
Please attempt this question first.
Hints
Please attempt this question first.
Match the following with their percentage composition of the total cell RNA.
1. i-b, ii-a, iii-c,
2. i-,a, ii-b, iii-c
3. i-b, ii-c, iii-a
4. i-c, ii-a, iii-b
| Column I | Column II | ||
| i. | m-RNA | a. | \(80 \%\) |
| ii. | r-RNA | b. | \(10-15 \%\) |
| ii. | t-RNA | c. | \(3 \%\) |
2. i-,a, ii-b, iii-c
3. i-b, ii-c, iii-a
4. i-c, ii-a, iii-b
Subtopic: Translation |
Please attempt this question first.
Hints
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3'AUCAGGUUUGUGAUGGUACGA5'
1. Phenylalanine, Methionine
2. Cysteine, Glycine
3. Alanine, Proline
4. Serine, Valine
3'AUCAGGUUUGUGAUGGUACGA5'
1. Phenylalanine, Methionine
2. Cysteine, Glycine
3. Alanine, Proline
4. Serine, Valine
Subtopic: Genetic Code |
71%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.
Study the following lists:
1. (i-c); (ii-e); (iii-d); (iv-b)
2. (i-d); (ii-e); (iii-b); (iv-c)
3. (i-d); (ii-e); (iii-a); (iv-b)
4. (i-d); (ii-b); (iii-a); (iv-e)
| List I | List II | ||
| i. | Vector | a. | Resistant to cotton bollworms. |
| ii. | Downstream processing | b. | Mobile genetic elements |
| iii. | Cry II AB | c. | Controls corn borer |
| iv. | Transposons | d. | Ti plasmid |
| e. | Purifying protein in biopharmaceuticals. |
2. (i-d); (ii-e); (iii-b); (iv-c)
3. (i-d); (ii-e); (iii-a); (iv-b)
4. (i-d); (ii-b); (iii-a); (iv-e)
Subtopic: Bt Crops |
82%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.
Select the important goals of HGP from the given options :
(i) Store the information for data analysis.
(ii) Cloning and amplification of human DNA.
(iii) Identify all the genes present in human DNA.
(iv) Use of DNA information to trace human history.
1. (i) and (ii)
2. (ii) and (iii)
3. (i) and (iii)
4. (ii) and (iv)
(i) Store the information for data analysis.
(ii) Cloning and amplification of human DNA.
(iii) Identify all the genes present in human DNA.
(iv) Use of DNA information to trace human history.
1. (i) and (ii)
2. (ii) and (iii)
3. (i) and (iii)
4. (ii) and (iv)
Subtopic: Human Genome Project |
79%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.
'A codon is a Triplet of bases was suggested by :
1. Marshall Nirenberg
2. Har Gobind Khorana
3. George Gamow
4. Francis Crick
1. Marshall Nirenberg
2. Har Gobind Khorana
3. George Gamow
4. Francis Crick
Subtopic: Genetic Code |
72%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.
The correct feature of double-helical structure of DNA as given by Watson and Crick is:
1. Right-handed helix, pitch is \(3.4~ \text {nm}\)
2. Left-handed helix, pitch is \(3.8~ \text {nm}\)
3. Right-handed helix, pitch is \(3.8~ \text {nm}\)
4. Left-handed helix, pitch is \(3.4~ \text {nm}\)
1. Right-handed helix, pitch is \(3.4~ \text {nm}\)
2. Left-handed helix, pitch is \(3.8~ \text {nm}\)
3. Right-handed helix, pitch is \(3.8~ \text {nm}\)
4. Left-handed helix, pitch is \(3.4~ \text {nm}\)
Subtopic: DNA Double Helix |
90%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.
Charging of tRNA during translation is necessary for :
1. Binding of anticodons of tRNA to the respective codons of mRNA.
2. Peptide bond formation between two amino acids.
3. Movement of ribosomes from codon to codon.
4. Binding of ribosomes to the mRNA.
1. Binding of anticodons of tRNA to the respective codons of mRNA.
2. Peptide bond formation between two amino acids.
3. Movement of ribosomes from codon to codon.
4. Binding of ribosomes to the mRNA.
Subtopic: Translation |
61%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.
If E. coli were allowed to grow in the culture medium for 80 minutes by Matthew Meselson and Franklin Stahl in their experiments, the proportion of light and hybrid density DNA molecule would have been:
1. 87.5% of light density DNA and 12.5% of hybrid density DNA.
2. 75.0% of light density DNA and 25% of hybrid density DNA.
3. 50% of light density DNA and 50% of hybrid density DNA.
4. 12.5% of light density DNA and 87.5% of hybrid density DNA.
1. 87.5% of light density DNA and 12.5% of hybrid density DNA.
2. 75.0% of light density DNA and 25% of hybrid density DNA.
3. 50% of light density DNA and 50% of hybrid density DNA.
4. 12.5% of light density DNA and 87.5% of hybrid density DNA.
Subtopic: DNA Replication |
67%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.
Select Question Set:
© 2024 GoodEd Technologies Pvt. Ltd.