Select Chapter Topics:
Q. No.1. Structural gene, Transposons, Operator gene
2. Inducer, Repressor, Structural gene
3. Promotor, Structural gene, Terminator
4. Repressor, Operator gene, Structural gene
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology1. Acetylase
2. Permease
3. Polymerase
4. Beta-galactosidase
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology| List I | List II | ||
| A. | Frederick Griffith | I. | Genetic code |
| B. | Francois Jacob & Jacque Monod | II. | Semi-conservative mode of DNA replication |
| C. | Har Gobind Khorana | III. | Transformation |
| D. | Meselson Stahl | IV. | Lac operon |
Choose the correct answer from the options given below:
1. A-III, B-IV, C-I, D-II
2. A-II, B-III, C-IV, D-I
3. A-IV, B-I, C-II, D-III
4. A-III, B-II, C-I, D-IV
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology| 1. | The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5' \(\rightarrow\) 3' |
| 2. | The DNA dependent DNA polymerase catalyses polymerization in 5' \(\rightarrow\) 3' as well as the 3' \(\rightarrow\) 5' direction. |
| 3. | The DNA dependent DNA polymerase catalyses polymerization in 5' \(\rightarrow\) 3' direction. |
| 4. | The DNA dependent DNA polymerase catalyses polymerization in one direction which is 3' \(\rightarrow\) 5'. |
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology3'TACATGGCAAATATCCATTCA5'
1. 5'AUGUAAAGUUUAUAGGUAAGU3'
2. 5'AUGUACCGUUUAUAGGGAAGU3'
3. 5'ATGTACCGTTTATAGGTAAGT3'
4. 5'AUGUACCGUUUAUAGGUAAGU3'
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology| List I | List II | ||
| A. | RNA polymerase III | I. | snRNPs |
| B. | Termination of transcription | II. | Promotor |
| C. | Splicing of Exons | III. | Rho factor |
| D. | TATA box | IV. | SnRNAs, tRNA |
Choose the correct answer from the options given below:
1. A-III, B-II, C-IV, D-I
2. A-III, B-IV, C-I, D-II
3. A-IV, B-III; C-I, D-II
4. A-II, B-IV, C-I, D-III
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology| List-I | List-II | ||
| 1. | DNA fingerprinting | I. | M. Meselson and F. Stahl |
| 2. | Pneumococcus | II. | A Harshey and M. Chase |
| 3. | E.coli | III. | F. Griffith |
| 4. | Bacteriophage | IV. | Alec Jeffreys |
| 1. | A-IV, B-III, C-II, D-I | 2. | A-IV, B-III, C-I, D-II |
| 3. | A-II, B-III, C-I, D-IV | 4. | A-III, B-II, C-I, D-IV |
Sorry!! currently, the explanation for the question is not provided. If you need further help, please email at support@neetprep.com with subject: Explanation Missing for Question Id: 456688
Sorry!! currently, the explanation for the question is not provided. If you need further help, please email at support@neetprep.com with subject: Explanation Missing for Question Id: 456688
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology| 1. | The codon is triplet |
| 2. | The code is nearly universal |
| 3. | The code has punctuations |
| 4. | Some amino acids are coded by more than one codon, hence the code is degenerate |
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology1. \(\gamma\)-radiation
2. Electromagnetic radiation
3. UV-Vis spectroscopy
4. X-ray diffraction
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology1. Vicia faba
2. Pisum sativum
3. Solanum tuberosum
4. Oryza sativa
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologySelect Chapter Topics:
© 2025 GoodEd Technologies Pvt. Ltd.